SOP: Characterization of Verotoxigenic Escherichia coli (VTEC) Colonies by Polymerase Chain Reaction (PCR) and Cloth-Based Hybridization Array System (CHAS) for Virulence Markers and Seven O Serogroups
GIFSQ — Global Institute for Food Safety & Quality
Principle
This method identifies seven O serogroups of verotoxigenic Escherichia coli (VTEC) as viable colonies isolated from foods on selective plating media. It is used to determine compliance with Sections 4 and 7 of the Food and Drugs Act and/or other relevant federal regulations.
A multiplex PCR and cloth-based hybridization array system (PCR-CHAS) confirms the identity of VTEC strain isolates by detecting genes for verotoxin types 1 and 2 (vt1, vt2, including subtype vt2f), intimin (eae), and the O serogroup markers O26, O45, O103, O111, O121, O145, and O157 in one assay.
CHAS is a DNA amplification and hybridization platform for interrogating colonies isolated on plating media for marker gene sequences associated with specific pathogenic bacteria. Each of the named features, including the vt2f variant gene, is detected with dedicated primers and capture probes.
Apparatus
Equipment
Biological safety cabinet (BSC) and/or PCR workstation with UV lights
Chiller block for 0.2 mL or 0.5 mL PCR tubes
Filtration apparatus (VWR Cat. no. 70690-276) with vacuum, or verified equivalent
Freezer capable of maintaining −20 °C
Heat block capable of accommodating microcentrifuge tubes and maintaining a temperature of 100 °C
Incubators capable of maintaining 35–37 °C and 45 °C
Microcentrifuge, small (“pop centrifuge”)
Micropipettors, adjustable to cover a range of volumes from 1.0 to 1000 µL
Photodocumentation system (optional)
Refrigerator capable of maintaining 4 °C
Thermal cycler equipped with a heated lid
UV cross-linker that can be adjusted to specified settings
Pre-cut polyester cloth (Sontara 8100) strips bearing a printed sample location grid with 15 cells — obtain from the Research and Development Section at the Ottawa Laboratory (Carling) of the Canadian Food Inspection Agency or purchase directly from APACE. No substitutions permitted.
Cold racks, to accommodate PCR and microcentrifuge tubes
Forceps
Wash bottles
Aluminium foil
Reagents
Media and Reagents — Strain Isolation
Rainbow Agar O157 (RBA) dehydrated media (Biolog, Inc., Cat. no. 80102)
Modified Rainbow O157 agar (mRBA) (see the preparation under Reagents)
DNase- and RNase-free water (ultrapure or molecular grade)
Primers, forward and reverse (see the Oligonucleotide Primer Sequences table)
Oligonucleotide probes (see the Oligonucleotide Probe Sequences table)
Control Cultures
Positive controls: E. coli O26, O45, O103, O111, O121, O145, and O157 strains, each containing a combination of the following genes — vt1 and/or vt2 (include at least one strain with subtype 2f) and eae.
Negative control: generic E. coli (negative for vt1, vt2 (including subtype 2f), and eae genes as well as the priority O serogroup markers).
Note: alternative positive controls for both the PCR and VTEC-7 CHAS —
A lysate prepared from a mixture of VTEC strains presenting all of the molecular markers targeted by the assay (vt1, vt2, vt2f, eae, O26, O45, O103, O111, O121, O145, O157). To prepare the lysate, combine one colony of each strain into 200 µL of 1% (v/v) Triton X-100 and then lyse as described under Preparation of Cell Lysates.
A pool of purified genomic DNA (gDNA) extracted from VTEC strains presenting all of the molecular markers targeted by the assay can be used as a source of template DNA and is suitable as a positive control. The pool should contain 5 to 50 ng/µL of DNA.
VTEC-7 Multiplex PCR Master Mix
Master mix may be prepared in larger quantities, aliquoted in portions of >150 µL into screw-cap microcentrifuge tubes, and stored at −20 °C for up to 2 months.
Reagent
Volume (µL)
[Final]
Molecular grade water
7
10 × HotStar Taq PCR Buffer*
8
1.6 ×
dNTP mix (10 mM)
1
0.2 mM
DIG-11-dUTP (1 nmole/µL)
0.5
10.0 µM
wzx O26 F+R mix (5 µM each)†
3
0.3 µM
wzx O45 F+R mix (5 µM each)†
2
0.2 µM
wzx O103 F+R mix (5 µM each)†
2
0.2 µM
wzx O111 F+R mix (5 µM each)†
2
0.2 µM
wzx O121 F+R mix (5 µM each)†
3
0.3 µM
wzx O145 F+R mix (5 µM each)†
2
0.2 µM
O157 F+R mix (5 µM each)†
2
0.2 µM
EAE F+R mix (5 µM each)†
3
0.3 µM
VT1 F+R mix (5 µM each)†
2
0.2 µM
VT2 F+R mix (5 µM each)†
2
0.2 µM
VT2F F+R mix (5 µM each)†
2
0.2 µM
IAC 1+2 mix (5 µM each)†
3
0.3 µM
Qiagen HotStar Taq (5 U/µL)
0.5
2.5 U
Template
5
Total volume
50
*This reagent is included with the Qiagen HotStarTaq polymerase kit.
†For primer sequences see the Oligonucleotide Primer Sequences table; for the preparation and storage of oligonucleotide working stocks see Preparation of F+R Primer Pair Mixes.
VTEC-7 Multiplex PCR Cycling Program
Program the thermal cycler for the following sequence of cycling parameters:
Step
Temperature
Time
1. HotStarTaq polymerase activation
94 °C
15 minutes
2. 35 cycles of:
Denaturation
94 °C
1 minute
Annealing
60 °C
1 minute
Extension
72 °C
90 seconds
3. Final elongation
72 °C
2 minutes
4. Hold
4 °C
indefinitely
Note: the PCR may be run overnight and the amplicons stored at 4 °C for up to 24 hours. For longer storage, PCR tubes containing amplicons may be stored at −20 °C for up to a week.
Oligonucleotide Primer Sequences
Primer name
Sequence (5′ → 3′)
Amplicon size (bp)
wzx O26-F
CACTCTTGCTTCGCCTGTTG
283
wzx O26-R
CGCGCTTCTAATTTCAGCGATAC
wzx O45-F
TATGACAGGCACATGGATCTGTGG
255
wzx O45-R
TTGAGACGAGCCTGGCTTTGATAC
wzx O103-F
TGCTCTATGCGCTCTTCCTC
205
wzx O103-R
GCCAGACACCTGCAACCGCA
wzx O111-F
TACAAGAGTGCTCTGGGCTTC
229
wzx O111-R
AACTAAGTGAGACGCCACCAG
wzx O121-F
AGGCGCTGTTTGGTCTCTTAGA
189
wzx O121-R
GAACCGAAATGATGGGTGCT
wzx O145-F
GCTGTGATGCTAGTGTATCCGA
211
wzx O145-R
AAGCCTCGTAGTGCAAGGGC
O157-F
CGGACATCCATGTGATATGG
259
O157-R
TTGCCTATGTACAGCTAATCC
VT1-F
GTGGCAAGAGCGATGTTACGGTTTG
182
VT1-R
ATGATAGTCAGGCAGGACGCTACTC
VT2-F
ACGAGGGCTTGATGTCTATCAGGCG
200
VT2-R
GCGACACGTTGCAGAGTGGTATAAC
VT2F-F
TTTGTCACAGTGATAGCAGAAGCTCTGCG
128
VT2F-R
CCCCAGTTCAGGGTAAGGTCAACATC
eae-F
GACCCGGCACAAGCATAAGC
384
eae-R
CCACCTGCAGCAACAAGAGG
IAC-1
CATAATATCACTCGCGTCCGTTGAAGCTTA
40
IAC-2
GACGAAATCGTAAGCTTCAA
wzx O26 primers (283 bp amplicon, designed from NCBI sequence no. DQ196413)
wzx O45 primers (255 bp amplicon, DebRoy et al., 2005)
wzx O103 primers (205 bp amplicon, designed from NCBI sequence no. AY532664)
wzx O111 primers (229 bp amplicon, designed from NCBI sequence no. AY863412)
wzx O121 primers (189 bp amplicon, Fratamico et al., 2011)
wzx O145 primers (211 bp amplicon, designed from NCBI sequence no. AY863412)
O157 primers (259 bp amplicon from rfbE gene, Paton and Paton, 1998)
VT1 primers (182 bp amplicon from vt1 gene, designed from NCBI no. M19473)
VT2 primers (200 bp amplicon from vt2 gene, designed from NCBI no. X07865)
VT2F primers (128 bp amplicon from vt2f gene, designed from sequences compiled in Scheutz et al., 2012)
eae primers (384 bp amplicon from eae gene, Paton and Paton, 1998)
IAC primers (40 bp amplicon, Leggate & Blais, 2006)
80102 Rainbow Agar O157 30 g packet (approx. 25 plates)
Prepare according to the manufacturer’s instructions.
After pouring plates, ensure they are thoroughly dry before use or storage by leaving the plates open in a clean laminar flow hood for 15 minutes. Store in the dark at 4–10 °C for up to two weeks.
Modified Rainbow O157 Agar (mRBA) with Novobiocin, Cefixime, and Potassium Tellurite — 500 mL
To make potassium tellurite stock solution (1 mg/mL), add 0.1 g potassium tellurite salt into 100 mL water. Filter sterilize. Store at 4 °C.
To make novobiocin stock solution (4 mg/mL), add 0.4 g novobiocin to 100 mL water. Filter sterilize. Store at 4 °C.
Rehydrate 1 vial of cefixime according to the manufacturer’s instructions.
Prepare RBA O157 according to the manufacturer’s instructions. After tempering media to 45-50 °C, aseptically add 625 µL novobiocin stock, 250 µL potassium tellurite stock, and 1 rehydrated vial of cefixime to the prepared media. Swirl to mix, pour, and store plates as described above for RBA.
20X SSC — 500 mL (can be purchased ready-made from VWR, Product No. CA12001-388)
Reagent
Amount
[Final]
Sodium chloride
87.66 g
3 M
Sodium citrate
44.1 g
0.3 M
Adjust pH to 7.0 with 5 N HCl
Ultrapure water (e.g. milliQ, nanopure)
to 500 mL
Dissolve the reagents in 400 mL ultrapure water. Adjust the pH to 7.0 with 5 N HCl, and then adjust the volume to 500 mL.
Autoclave at 121 °C, 15 psi for 15 minutes. Store at room temperature for up to 1 year.
1 M Tris HCl pH 8.0 — 100 mL (can be purchased ready-made from Sigma, Product No. T2694)
Add 12.11 g of Trizma base to a beaker with 80 mL ultrapure water (e.g. milliQ, nanopure). Add water to 100 mL. Stir until dissolved. Adjust pH to 8.0 with 5 N HCl. Autoclave at 121 °C, 15 psi for 15 minutes. Store at room temperature for up to 1 year.
1 M Magnesium Chloride — 100 mL (can be bought ready-made from Sigma, Product No. M1028-100ML)
Add 20.33 g of magnesium chloride to a beaker with 80 mL ultrapure water (e.g. milliQ, nanopure). Add water to 100 mL. Stir until dissolved. Autoclave at 121 °C, 15 psi for 15 minutes. Store at room temperature for up to 1 year.
5 M Sodium Chloride — 100 mL
Add 29.22 g of sodium chloride to a beaker with 80 mL ultrapure water (e.g. milliQ, nanopure). Add water to 100 mL. Stir until dissolved. Autoclave at 121 °C, 15 psi for 15 minutes. Store at room temperature for up to 1 year.
High Salt Buffer (pH 8.0) — 100 mL
Reagent
Volume (mL)
[Final]
1 M Tris-HCl
10
0.1 M
1 M Magnesium chloride (MgCl₂)
1
0.01 M
5 M Sodium chloride
3
0.15 M
Ultrapure water (e.g. milliQ, nanopure)
to 100 mL
To make the High Salt Buffer, mix the components in a sterile container. Store at room temperature for up to 1 year.
2× Hybridization Solution (HS) Stock — 200 mL
Reagent
Amount
[Final]
20 × SSC
100 mL
10 ×
10% Sodium dodecyl sulfate (SDS)*
800 µL
0.04%
10% N-lauroyl sarcosine*,†
4.0 mL
0.2%
Blocker (non-fat dry milk powder)
4.0 g
2.0%
Ultrapure water (e.g. milliQ, nanopure)
to 200 mL
*Filter-sterilize these stock solutions. Do not filter-sterilize or autoclave the finished 2× hybridization solution.
†A 20% N-lauroylsarcosine solution is available from Sigma (L7414); if using it, adjust the volume to 2.0 mL.
In a beaker with a stir bar, add sodium dodecyl sulfate and N-lauroyl sarcosine to 60 mL ultrapure water. Add 100 mL 20X SSC, mix (if detergents precipitate, heat in a 37 °C water bath). Add blocker and stir vigorously for at least 1 hour, until well dissolved. Let the solution stand until bubbles disappear and add water to 200 mL. Do not autoclave; store in 25 mL aliquots at −20 °C for up to 1 year.
1× HS + 50% Formamide (HSF)
1 part 2× HS + 1 part formamide
This solution should be prepared fresh the day of the experiment.
Add the first three reagents to 800 mL water, stir until completely dissolved. pH solution before adding Tween 20. Add Tween 20 and then add water to 1 L.
There is no need to autoclave this solution. It can be prepared in a large volume (4–8 L) and stored at room temperature for up to 1 year in a carboy fit with a spigot for ease of use.
PBST-B
PBST + 0.5% (w/v) non-fat dry milk powder blocker
Add 0.5 g blocker to 100 mL PBST
This can be prepared ahead of time, dispensed into Falcon tubes in 25 mL aliquots, and stored at −20 °C for up 1 year.
PBST-B + Anti-DIG-POD
1:2000 dilution of Fab fragments of sheep anti-digoxigenin-conjugated with horseradish peroxidase (anti-DIG-POD) in PBST-B
1 µL anti-DIG-POD in 2 mL of PBST-B
This solution should be prepared the day of the experiment and protected from light until use.
1% Triton X-100 — 50 mL
0.5 mL Triton X-100 in 49.5 mL ultrapure water (e.g. milliQ, nanopure). Filter sterilize. Store at room temperature for up to 1 year.
Oligonucleotide Preparation and Storage
Dried oligonucleotides: resuspend dried oligos in 1X TE (Tris-EDTA buffer pH 8, 10 mM Tris, 1 mM EDTA) at a 100 µM concentration and store at −20 °C. To avoid repeated freeze/thaw cycles of oligos, it is advised to prepare 25 µL aliquots of 100 µM stocks dispensed into screw-cap tubes. The same tubes are used for probe dilution and denaturation as described under Probe application.
“Lab-ready” oligonucleotides: oligos may be purchased “lab-ready” at 100 µM concentration. A source of “lab-ready” oligos is Integrated DNA Technologies, Inc. Aliquot as described above.
Preparation of F+R Primer Pair Mixes
To reduce the number of pipetting steps when preparing the PCR master mix, the forward and reverse primer pair for a given target may be mixed in equimolar amounts as follows:
Mix 25 µL of each the 100 µM forward and reverse primer stocks for a given primer pair (F+R). In this mix the primers are now at a concentration of 50 µM. Store the 50 µL aliquots of F+R mix at −20 °C.
When preparing the PCR master mix, dilute the 50 µM aliquot of F+R primer mix 1:10 in 1X TE, to a working concentration of 5 µM (e.g. 5 µL F+R primer mix added to 45 µL 1X TE).
Aliquoting Oligonucleotide Probes
We suggest that oligo probe aliquots (10 or 20 µL are convenient volumes) be dispensed in the same screw-cap tubes used for the denaturation step under Probe application.
Additional media and reagent preparations
Brain Heart Infusion (BHI) Agar
Note: the item is used in the agar form; the entry below gives the broth form
Basal Medium
Calf brain, infusion from — 200.0 g
Beef heart, infusion from — 250.0 g
Proteose peptone — 10.0 g
Dextrose — 2.0 g
Sodium chloride (NaCl) — 5.0 g
Sodium phosphate (Na₂HPO₄) — 2.5 g
Distilled water — 1.0 L
Final pH 7.4 ± 0.2
Complete Medium: dissolve the ingredients in 1.0 L of distilled water; distribute as required (tubes or flasks); sterilize at 121°C for 15 min
MacConkey Agar
Basal Medium
Peptone — 20.0 g
Lactose — 10.0 g
Bile salts No. 3 — 1.5 g
Sodium chloride (NaCl) — 5.0 g
Neutral red — 0.03 g
Crystal violet — 0.001 g
Agar — 13.5 g
Distilled water — 1.0 L
Final pH: 7.1 ± 0.2
Complete Medium: suspend the ingredients in 1.0 L of distilled water and heat to boiling with frequent swirling; autoclave at 121 °C for 15 min and cool to 45–50 °C; dispense the medium into plates and allow to dry with the lids partially removed
10% N-Lauroylsarcosine solution — 100 mL
N-Lauroylsarcosine — 10 g
Distilled water — to 100 mL
10% Sodium Dodecyl Sulfate (SDS) solution — 100 mL
Sodium dodecyl sulfate — 10 g
Distilled water — to 100 mL
Sample preparation
Food samples are handled and subjected to enrichment, detection, and isolation according to MFLP-52, Isolation and identification of priority verotoxigenic Escherichia coli (VTEC) in foods.
Procedure
Preparation of Cell Lysates
Pick an isolated colony from one of the following validated plating media: Brain Heart Infusion agar (BHIA), MacConkey agar (MAC), Rainbow agar O157 (RBA), or Modified Rainbow O157 agar (mRBA)
↓
Suspend the colony in 200 µL of 1% (v/v) Triton X-100 in a microcentrifuge tube with a secured lid (e.g. a screw-cap tube or a tube secured with a “lid-lock”)
↓
Set up a lysis buffer negative control tube by dispensing 200 µL 1% (v/v) Triton X-100 and carrying it through the rest of the procedure
↓
Vortex to mix
↓
Heat at 100 °C for 10 minutes in a heat block
↓
Cool in a rack on the bench to room temperature for 5 minutes
↓
Pulse-spin for a few seconds to bring down condensation accumulated in the tube cap
VTEC-7 Multiplex PCR
Label reaction tubes
↓
Prepare VTEC-7 multiplex PCR master mix (as described under VTEC-7 Multiplex PCR Master Mix) and dispense 45 µL into reaction tubes
↓
Add 5 µL of the colony lysate supernatant obtained under Preparation of Cell Lysates to the corresponding PCR reaction tube
↓
Insert tubes in a thermal cycler and proceed with the PCR amplification using the program described under VTEC-7 Multiplex PCR Cycling Program
Note: the PCR may be run overnight and the amplicons stored at 4 °C for up to 24 hours. For longer storage, PCR tubes containing amplicons may be stored at −20 °C for up to one week.
Preparation of Cloth Strips
Use polyester cloth strips 4 x 6 cm (Sontara 8100) bearing a printed sample location grid with 15 cells
↓
Place the cloth strips onto the filtration apparatus. Several strips can be processed simultaneously, provided they do not overlap. Saturate the cloth strips with 95% ethanol for 1 minute.
↓
Wash the strips 7 times with ultrapure or molecular grade water, using a squeeze bottle. To wash, stop the vacuum, saturate the strips with water, and open the vacuum to remove excess water.
↓
Leaving the vacuum on, pick up the cloth strips with forceps and place them in an empty Petri dish or tray. Do not stack the cloth strips.
↓
Dry the strips, overnight uncovered, at room temperature away from light. Once dry, strips may be stored stacked inside a clean dry container (e.g. Petri dish or plastic bag) at room temperature, away from light.
Note: when a large number of strips is washed, and placed to dry in a drawer or cupboard, the drying time required should be extended as the increased humidity caused by evaporation will lengthen drying time. An indication that the strips are not completely dry is that when the probe solution is applied to the cloth, the wet spots are not visible on the cloth.
Probe application
Note: the steps in this section can be performed while the VTEC multiplex PCR is running.
Prepare probe stocks at a concentration of 100 µM in TE buffer. For preparation of working stocks, and storage, refer to Oligonucleotide Preparation and Storage. The probes are: O26, O45, O103, O111, O121, O145, O157, EAE, VT1, VT2, VT2F and IAC.
Dilute probes in High Salt Buffer containing 30% (v/v) ethanol to a final coating concentration of 10 µM as follows:
↓
To prepare 100 µL of probe coating solution: mix 10 µL of 100 µM oligo probe stock with 59 µL High Salt Buffer in a 1.5 mL-capacity screw-cap tube
↓
Denature the probes by placing in a heat block at 100 °C for 10 minutes
↓
Snap-chill the probes by immersion in ice water for 5 minutes
↓
Centrifuge tubes for a 10 second pulse to bring down condensate, and return the tubes to the ice bucket immediately
↓
Add 31 µL of cold 95% ethanol to obtain a final probe concentration of 10 µM. Mix well by flicking the tube with your fingers. Keep tubes on ice during the procedure (or a chiller block at 4 °C).
Note: do not centrifuge the tubes after adding and mixing the ethanol or the solution will separate into two phases.
↓
Place the cloth strips to be spotted in a suitable tray that fits in the UV crosslinker and use a pipettor to spot 7 µL of each of the twelve denatured probes (O26, O45, O103, O111, O121, O145, O157, EAE, VT1, VT2, VT2F and IAC) in discrete spots onto each cloth strip
Note: a multipipettor may be used to spot rows of five probes simultaneously onto the cloth strips. Set up 0.2 mL PCR tubes (or cut a five tube strip) onto a chiller block. After mixing the ethanol, transfer the chilled probe solutions into the tubes (or tube strip) in the proper order chosen for spotting (see the spotting pattern below). Proceed to spot a row of 5 probes at a time using a multipipettor, repeat for the second row.
Spotting Pattern for VTEC CHAS Strips
1
2
3
A
O26
O121
VT1
B
O45
O145
VT2
C
O103
O157
EAE
D
O111
IAC
VT2F
E
Dry the probe-coated strips uncovered in a 35–37 °C incubator for 30-40 minutes
↓
After the drying period, transfer the tray to a UV cross-linker set at 254 nm, 120 mJ/cm² and expose to UV light in order to covalently bind the probes to the cloth strips
Note: this step is critical to ensure that probes will be bound to the strips.
↓
Saturate each strip with 2.5 mL of 1× Hybridization Solution (as prepared under Reagents) to block non-specific binding sites on the cloth. Block the cloth strips for at least one hour at 35–37 °C with the lids on. The strips can be blocked for up to 3 hours.
↓
Use forceps to transfer the cloth strips to the filtration apparatus for washing. Several strips can be processed simultaneously, provided they do not overlap.
↓
Wash the strips 5 times by saturating the strips on the filter with PBST (as prepared under Reagents) using a squeeze bottle and applying vacuum suction between washes
↓
While the vacuum is still on, use forceps to pick up the cloth strips and place them in Petri plates. Strips can be used immediately, or placed in a single layer in an uncovered Petri dish (or other appropriate container) away from light to air-dry at room temperature overnight.
↓
Dried, probe-coated strips can be stored in Petri plates, sealed with Parafilm at 4 °C for up to two weeks. For longer storage, dried probe-coated strips can be sealed in vacuum pouches, and stored at 4 °C for up to 6 months.
Hybridization and Colorimetric Detection
Note: manipulate cloth strips using tweezers. Rinse tweezers in a small beaker containing water or PBST buffer between each treatment.
Place probe-coated strips in individual Petri plates (or use divided Petri plates to assay two strips per plate). A pencil can be used to label strips (e.g. with dots corresponding to the PCR reaction or sample number).
↓
Transfer the entire 50 µL of each of the DIG-labelled multiplex PCR products into a microcentrifuge tube (use “lid-locks” or screw-cap tubes to prevent the tubes from popping while heating)
↓
Denature PCR products in a heating block at 100 °C for 10 minutes, followed by rapid chilling on ice water for 5 minutes. Pulse spin tubes in a centrifuge to bring down condensation before opening tubes during the next step.
↓
Add 1.5 mL of ice-cold hybridization solution containing 50% formamide (HSF) to each microcentrifuge tube containing 50 µL of denatured, labelled PCR products
↓
Vortex for 2 to 3 seconds to mix solution. Pulse spin in a microcentrifuge before opening. Continue to work on ice.
↓
Carefully saturate each cloth strip with the denatured PCR product in HSF and incubate for 15 minutes at 45°C ± 1°C with the cover on
Note: the anti-DIG-POD in PBST-B solution must be prepared fresh the day of the experiment, either prior to starting the procedure or during the 45 °C incubation in this step.
↓
Transfer the strips to the filtration apparatus using forceps. Wash the strips 5 times with PBST (using a squeeze bottle) and applying vacuum suction between washes.
Note: rinse the forceps in a small beaker containing distilled water between each treatment.
↓
Keeping the vacuum open, transfer the strips to a dry, clean Petri dish or tray. Several strips can be placed in the same Petri dish or tray without overlapping.
↓
Add 1.5 mL of a 1:2000 dilution of anti-DIG-POD in PBST-B (PBST + 0.5% [w/v] blotting grade non-fat dry milk powder blocker) as prepared under Reagents, to each strip. Incubate for 10 minutes at room temperature and protect from light.
Note: during this incubation, dispense the volume of tetramethylbenzidine (TMB) membrane peroxidase substrate that will be used for the experiment into a polypropylene tube. Keep the tube at room temperature and protected from light.
↓
Wash the strips 5 times with PBST. More than one strip can be washed at a time for this step. Use forceps to transfer washed strips to the lid of the Petri dish.
↓
Add 1.5 mL of TMB to each strip. Protect the strips from light and allow the colour to develop for up to 10 minutes. Blue/purple spots coinciding with an appropriate probe indicate a positive reaction.
↓
Record results and, if desired, photograph the strips using a camera or a UV transilluminator on the same setting used for gels stained with ethidium bromide.
Interpretation of Results
Formation of a blue precipitate on the CHAS strip coinciding with a given probe is considered a positive reaction for the gene sequence corresponding to that probe.
Isolates are considered to be VTEC when colour reactions occur with the verotoxin (vt1 and/or vt2 and/or vt2f) gene probes.
If colour reactions also occur with the gene probes for eae, and one of the O antigen marker in addition to verotoxin, report the isolate as VTEC along with the relevant vt type, eae and O-type, as appropriate.
Isolates which are negative for verotoxin are not considered VTEC even if colour reactions with eae or O-type gene probes occur.
The negative control should only produce a colour reaction with the IAC probe feature. If additional colour reactions occur for the negative control, the PCR and/or CHAS should be repeated.
The positive control mixture (i.e. lysate or gDNA) from all target strains (if used) should produce a colour reaction with all probe features on the array.
For samples producing reactions with one or more gene probes, the IAC signal may be weak or absent due to consumption of PCR reagents. In this case, the reactivity observed at the other gene probes is taken as confirmation of the validity of the test procedure.
The results of the CHAS test are not valid in the absence of a colour reaction with the IAC probe on the array. Failure to see an IAC reaction in the absence of other conclusive positive reaction(s) is evidence of either (i) inhibition of the PCR by sample matrix contaminants; (ii) failure of one of the detector reagents; or (iii) omission of a critical component in the procedure (e.g. PCR reaction mixture). Repeat the CHAS procedure for samples with a failed IAC.
Precautions
The laboratory Supervisor must ensure that completion of the analysis described in this method is done in accordance with the International Standards reference ISO/IEC 17025 (latest version): “General Requirements for the Competence of Testing and Calibration Laboratories”.
It is the responsibility of the laboratory to ensure equivalency if any variations of the media formulations listed here are used (either product that is commercially available or made from scratch).
References
Health Canada, Health Products and Food Branch, Compendium of Analytical Methods, Volume 3, Laboratory Procedure MFLP-70, July 2020: Characterization of Verotoxigenic Escherichia coli (VTEC) Colonies by Polymerase Chain Reaction (PCR) and Cloth-Based Hybridization Array System (CHAS) for Virulence Markers and Seven O Serogroups.
Bilge, S.S., Vary, Jr., J.C., Dowell, S.F., and Tarr, P.I. 1996. Role of the Escherichia coli O157:H7 O side chain adherence and analysis of an rfb locus. Infection and Immunity, 64: 4795–4801.
Blais, B.W., and Martinez-Perez, A. 2011. A simple PCR-based macroarray system for detection of multiple gene markers in the identification of priority enterohemorrhagic Escherichia coli. Journal of Food Protection 74: 365–372.
DebRoy, C., Fratamico, E.R., Davis, M.A., and Liu, Y. 2005. Development of PCR assays targeting genes in O-antigen gene clusters for detection and identification of Escherichia coli O45 and O55 serogroups. Applied and Environmental Microbiology 71: 4919–4924.
Fratamico, P.M., Bagi, L.K., Cray, W.C. Jr., Narang, N., Yan, X., Medina, M., and Liu, Y. 2011. Detection by multiplex real-time polymerase chain reaction assays and isolation of Shiga toxin-producing Escherichia coli serogroups O26, O45, O103, O111, O121, and O145 in ground beef. Foodborne Pathogens and Disease 8: 601–607.
Leggate, J, and Blais, B.W. 2006. An internal amplification control system based on primer-dimer formation for PCR product detection by DNA hybridization. Journal of Food Protection 69: 2280–2284.
Paton, A.W., and Paton, J.C. 1998. Detection and characterization of shiga toxigenic Escherichia coli by using multiplex PCR assays for stx1, stx2, eaeA, enterohemorrhagic E. coli hlyA, rfbO111, and rfbO157. Journal of Clinical Microbiology 36: 598–602.
Scheutz, F., Teel, L.D., Beutin, L., Piérard, D., Buvens, G., Karch, H., Mellmann, A., Caprioli, A., Tozzoli, R., Morabito, S., Strockbine, N.A., Melton-Celsa, A.R., Sanchez, M., Persson, S, and O’Brien, A.D. 2012. Multicenter evaluation of a sequence-based protocol for subtyping Shiga toxins and standardizing Stx nomenclature. Journal of Clinical Microbiology 50: 2951–2963.
Schmidt, H., Beutin, L., and Karch, H. 1995. Molecular analysis of the plasmid-encoded hemolysin of Escherichia coli O157:H7 strain EDL 933. Infection and Immunity 63: 1055–1061.
